Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:146-h2   

Cenix:146-h2RNAiCenix:146-h2
PCR_productcenix:146-h2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C25H3.6a Source_evidenceePCR736WS150 Sequence/Annotation Release
C25H3.6b Source_evidenceePCR48WS150 Sequence/Annotation Release
Overlaps_Gene C25H3.6 Source_evidenceePCR736WS150 Sequence/Annotation Release
Chunk_score Abs_score673
Max_abs_score673C25H3.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII56624155663589
Overlaps_transcript C25H3.6a Source_evidenceePCR736WS150 Sequence/Annotation Release
C25H3.6b Source_evidenceePCR491WS150 Sequence/Annotation Release
WB_DNA_textTH:146-h21175gttctttctccgagtgtcgccaggctcatgcagcgaggaattacacctaatacaccagctggaaggcgggtcacatctactggccttccaggtataattcgatttaaacaagttgattgttttaaatcgactttacaggttcccaacagcgccttgtctcgccagcgaacggttcatatgctccacgtagtcaagtttcgcctggcgagtcgactcctgttgctgcctccgtcgttgtgaacggaatgcacaagtcagcgtcagttggtggagatcttctgaaacatgcaacagcatcactttctacaaaaccaatcacaccaaaggagaatggaaaacggaaagccgtcgatgaagctgctgctccctcaatcaagagaaccaaaacggctgctgctgcactttcagtatcaattactcctggaactccaacaacaatggctccacaaacgcctaccatgtctgtttctgctgctagaaaagctgttcagagcactagtgagctcttcgctcaaatgagccagacacttcctgggcacattgacatcggtacagacattcgggagcacgaggaacgtgtgaaaagagagctcaaagatgaagaggtgagcagattatgaagatttctagttgaactaaaggaatttacaatttctagagtgaatctagttacaagtaaaataaaaattattcaaacacgtttcagctggcacacagtcttcaatcgtctgctagctacggaaacttcggttcagcaacaacaactgaacggaaaaagcggaaatacgagcgaaaaattcagaagggcactgcaccgggcactccagcagcagtggcatcccccttgttgcagacgacaacgatggtcacgcctccgtcttcaagtgagttgtgtttttctttttctctcactcactattctctgttgcttctgcttgtcgtcgtttacacactcactaatccatcattgtatctcaactaatatagttcagtaatcggaaaacgaggttgaaaacttaccgctaaaaattaagaagtattgaaatatattttttcaaattgactagtgagatgggtctcgaaatagtgagaacagggattggtatgaaaatgggcagtgaaaaagcacagaaaagagacatagacagataggatgagtcctttgggggaaagtc