Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:148-b4   

Cenix:148-b4RNAiCenix:148-b4
PCR_productcenix:148-b4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF53H1.1 Source_evidenceePCR554WS150 Sequence/Annotation Release
Overlaps_Gene F53H1.1 Source_evidenceePCR554WS150 Sequence/Annotation Release
Chunk_score Abs_score513
Max_abs_score513F53H1.1
Specificity_index0.435
Rel_score1
Map_statusUnique_ePCRIV13077911308844
Y73B3B.5 Chunk_score Abs_score290
Specificity_index0.246
Rel_score0.565
Y73B3B.4 Chunk_score Abs_score376
Specificity_index0.319
Rel_score0.733
Overlaps_transcriptF53H1.1 Source_evidenceePCR554WS150 Sequence/Annotation Release
WB_DNA_textTH:148-b41054tccactttccagatttcccacaaaatggaaggtttttaaataattttttttcaatttttcttgattttttccgaattttaatataaaaattcccgattttcaacttctcccgccgcacctcaatatagaaattcttcttgaatttccgataatagaccttagaatggtcagtttgtgccaacattcgtcctttatgacataatgatgctgcagccgtctcaatatcaaaatcatcaataaccatatccatattatcctcattttccagcacttgtcccttttcgggctccggcttctcctcctgcacaattgtcacaattccagacgctttttgcgtggagtttccggtttttttggcgtttttagtggcaatttctttcataaaagcgtccagagggtcctcttcgtcgtctgtatccattttttcgactttttcttccattttcaccgggttttcctctgaaattccctcatttttgatatcaaattcgtcttcatcatcctcatcctccagattccagggctttttctcagatttttcatcagattgctcagattgtagatcaagctcttccttcttcttttgggctctccacttctccacattacgacgcctacgctcgactccctgtagtaattcggcttctttcattttcataacttcttcggtgtctgcaaattgataaaattaaggggtttttttgcaaaaaattgagaatttgggctttttcacacttttatgggtaaaagccggctggaaattcaattttttgggtgaaatttgagaaaactcactaaaatgttaggttttttcgtaacaaaaagttgaaaattggcctatttcttgcgaaaaaaacataaaattcacacttttctgggtgaaaatcgtctagaaattcagttttttaggtggaaattgaaaaaaaatcgcttaaatttttatgttttcttgggaaaaaggtaagaactctatggattttgcatgaaaagttcataaaattcacattattttttgcaaaaaccatacaaatcagtggaaaattggaaaaatcgc