Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:148-e1   

Cenix:148-e1RNAiCenix:148-e1
PCR_productcenix:148-e1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF44A6.2 Source_evidenceePCR579WS150 Sequence/Annotation Release
Overlaps_Gene F44A6.2 Source_evidenceePCR873WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRX1020103410202233
Overlaps_transcriptF44A6.2 Source_evidenceePCR873WS150 Sequence/Annotation Release
WB_DNA_textTH:148-e11200ggccatgtgtctcgatttttccgatgttcgatgtcgatgtttttggttttactcgcatacgttttcataatcaataacgaaagtaattctacaactcgttgaaaattaaataattaatgtttctctattgacatcggtacgcctttcatttttggagctcgattggactggacctacagagggttattaaaaactgcaatattgaagttattaaggcattctttcaaatactaaatttatagcacggaaatcattttaatgataccaatcgtgaataaaccagaaccgtctggttgtgatacttatgacaaaaaagattaagattattgagaaagaaagcaaaatgctggattgtggcaatccttgcaagaattattaaacagcagtcatcagacacgtgacttttgggttggaaacgggcaggaaggagagattgaatacttaactacattaaagcgaaattatttgaaggtgaattgtgttggaatgaaaacggatgagaatctgacaaaggtggctagcagtgaacgggagtctgttgttgatttggcgttggctgctgtggttgagggctctgatgctctggagcaggagtatattggttctgaattaagtttaatattaacctcccatctatagctccttaataattacctcttggttgttatggttaacaggcaacggaagtgttgagagttggaacatttccacaacgagaggaggcaggtttaaaaacgacaaattttctcgaagaatattgagttgctgtttatgtagctcatctggaaaaagttgatataaaataaaacaaaatatcagtatgaaatacaacttactaagtcgattcaattcatgaatacatttcataagttgtttgtatgtatcgcatccgtcaatgcggcatgtcattttttggaaaagaactttcttgtaaaaatcaaacatttccagcaactgcaattgacttttgaagttagtagaaaattgttgttccgtggttagtggctggcaaagaataaggacaatgaatagtgcaatatctccgtctgtacatccaattgtaatgatatggtttgcaaatgcaagcatttcgtccgccaatgatccatagagcagttgaagagacttaaagtcaatgagtcttccatctcgaagcataagccctctgttcgacattccacgaacaatgcgaagcaagta