Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:149-e3   

Cenix:149-e3RNAiCenix:149-e3
PCR_productcenix:149-e3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR04F11.5 Source_evidenceePCR538WS150 Sequence/Annotation Release
Overlaps_Gene R04F11.2 Source_evidenceePCR40WS150 Sequence/Annotation Release
R04F11.5 Source_evidenceePCR538WS150 Sequence/Annotation Release
Chunk_score Abs_score454
Max_abs_score454R04F11.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1231998312321077
Overlaps_transcript R04F11.5 Source_evidenceePCR538WS150 Sequence/Annotation Release
R04F11.2.1 Source_evidenceePCR40WS150 Sequence/Annotation Release
WB_DNA_textTH:149-e31095gcagcaaatcaatctcgtcagtattaacatcataatcaacaaatgctgtttccatacgatgccatctaccgagagctccaatgtcaacaatgttcctccacaactctgtccatggccaatcttttagatttgaatcttgtgaagaatatattctaagtttatcgttgtaatcgctagcaaccaagagcgaaaagaaccagagattgtaataatgcaatcgattttggctgatgagaaagtcgcgagcagttaattctttagctgaaaatagccattacttcatagcatttagaatgtggaacatacttgtagccggattatgctcagaattcgggaccaaaactaacttttgtcgtctctcgcataaataatcatacatttccagctctgttggatttgtctgatatgcataggttaaaaaaccgagcccagagaaaacaactcctgaaattgatcaataagaatgataggtagagaggtgtcataccagctttaacaggtctatctttacatccttggacagtttccctagctacagtagcataatcatttcccattcgtttaaaatattctttgatgctgattccggtccgctggaaaaagcctttcactgaagcagcagccatctgaaatgaataattgttaacgaaacaactgaataaaaaaagataacgaaacgaaaacgtttaaaataacttttaaaagacaaacgtatgcaaattaacagcataacgaataggtaaaacggctttttgaagaactcggaaaaaataaaggcaatattcgagatttttgattcttgacagaataagtaagtagtcaaaagaagaaatgcaatgtaaaatacttttgcaaacatttttgaacgcaaaataatttttttttgaaaaaaaaatctaactgccaaacgacactccgaaataacgcaggtctcgcttcgatgagggggtacggtgacactcgtttcagctgtagcattttctttcttttcgcgcggtgctgtggtaatatcaatatttttcctgtttttagtgagtttctgttgattttgataatttttttcaaacaagtttatccagcttacaaacccgaaaa