Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:149-f3   

Cenix:149-f3RNAiCenix:149-f3
PCR_productcenix:149-f3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR05D11.5 Source_evidenceePCR510WS150 Sequence/Annotation Release
Overlaps_Gene R05D11.3 Source_evidenceePCR89WS150 Sequence/Annotation Release
Chunk_score Abs_score68
Specificity_index0.11
Rel_score0.123
Map_statusBottom50_percentile_ePCRI85918748592962
R05D11.5 Source_evidenceePCR635WS150 Sequence/Annotation Release
Chunk_score Abs_score551
Max_abs_score551R05D11.5
Specificity_index0.89
Rel_score1
Map_statusBest_ePCRI85918748592962
Overlaps_transcript R05D11.5 Source_evidenceePCR635WS150 Sequence/Annotation Release
R05D11.3.1 Source_evidenceePCR89WS150 Sequence/Annotation Release
R05D11.3.2 Source_evidenceePCR76WS150 Sequence/Annotation Release
WB_DNA_textTH:149-f31089ccacacagtttcgtgtcgttttactatttcgcacaatttcaaacttctagtttgcaaatcggttcaaactaaagaatgaagtttttatcattttctttccgagatatcgagaaaattttgtttaattcgttattattagtggtttttcaacctttacaatacctttgactttttcagcaatgacctcaaaaatataaaaattaaatacagatggtgaaacaagcaacaaaagggcagaaagagatctatgaggagaatcagaagactgtcaccacttatagtgtggctagcacgattagcatggtaaacatttgtaatttcacatttcaacgattttttaaaaattgttttaggcaatctactattcatcgtgtatgtttctgagccagtgctcttccaccgattatgtattttttgctgtctcagcgctcgtgcagatctttgctattcttttcatgaaatctttagctagtaagtttgtcttacccattaattttttgtattaatctgaaattatgattttagaagcaaagcttgacgataaaggacatgttttggatgctggtgccgatttgaacgatccagaagcattcggagaatactgtaaagacgccattattctgacagtcattattcaagttagtttttgcaaaaaaaaagtgtgggaaagtgcgcattaatagttcaaaaatgaaatattctatcttcaaatgtataatttactctgttcccagatcatctcactctattctacatacggattccttttgctcctcgcctttcctggagcagccacatacaaatttgttgctggattccttctaccatggttgaccgctggatcagactcagatgaaatggatgacaagaaacagaagaaattggacagaagaagagaaaaagtcgtgtacagacgttaaattataacttctagaaaacaatgttccctaagtcacttcaaattttaaattataatcgtatttatttattgcatacttgtaatgtttatctattcaaatatttttttttaatacacattttttccaaaaattttaatgtttttattcatggttatttttcccgatcgct