Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:151-a1   

Cenix:151-a1RNAiCenix:151-a1
PCR_productcenix:151-a1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW06D12.4 Source_evidenceePCR752WS150 Sequence/Annotation Release
Overlaps_Gene W06D12.4 Source_evidenceePCR752WS150 Sequence/Annotation Release
Chunk_score Abs_score668
Max_abs_score668W06D12.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1772236817723867
Overlaps_transcriptW06D12.4 Source_evidenceePCR752WS150 Sequence/Annotation Release
WB_DNA_textTH:151-a11500gtgatttttgcggtccacttcattttccggtattggacaattaccaagtaagttgcaccaaatttttttaaagcttttacaaattccttgggaattttagaaatttttctgggaattttctaaaacattttccgttttttttttagaatgttcagaaatattttagaattttgttgaaaattttcaaactttctcaattttgtttttgaacaattttcaactttatccatatttcagaaatgacaaaatccgttttttcaactttccatacttcatctgctggataatcgggagctactattttggagtagaatactcctatattctccacgtagagttctcagagagacccgacaaaactgaatttatccggtacatatcggcttacacttgtttaaaaaattttgaattttcagtcaaaaaatgtcggaagactttgggcacacaatggacgagatcacctatatggccgccagatttgtgaaatattccgaagaagcgggggcgttaactattgattggcgccaagttggattctattttgcagccacgaaaactatgattttgagctttattatattgatttattgcggaattgctatcactaaaactatacggaaggacctgaaaagtttaagatccaaggaacggctgaggcttgagcttaatctgtttttggcgcttattgtgcaggtgagagttttattattagaacaattttttttaatttggcatcttaaaacactttcaaaaaattttaaaattttttctcaaaaatttaaaattctgtcacttttggcgcagtgcgatttttgaaatttgccaatcacaagtccggggttcaagtccggctagtggtcaagtattttttctcacgatgtagtagccttttcacaaatttttgaggctgaaaaattgtttctgaactatttttctaaaaaatgtccgattggtgcagtgcgattttcgagttctgccaatcacaagtccgggaaacgcactgtgccaaatattttttctagatgtaattaggctattccttaactaaataatctttataagtagattttagttatattttttcctgaattttcaaataaaaaaaccagcattttagactgtttcggaaaaatatccaaatttcttatcaaaaattgttttttagtcggattttcaatattctttgtttcaaaagttacggtttcagacagtaatccccgttctcatgatctactgcccgttccttctcatgtggaatttccccgttttcctcggcatagaaaccgcccgtctcaccggaatgggcgtggccttgtatccgggaatcgacccgttggctattattttcatagtggccaactaccgaagagcacttcttaagcctttcagaaaagtttttttggttcaaccggcaagtagtaccgtcagagatatctcttcgacaagccgtgctttggcccaagttgccggaaatcaagtggctcctgccgtggttattaa