Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:154-b7   

Cenix:154-b7RNAiCenix:154-b7
PCR_productcenix:154-b7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY105E8A.23 Source_evidenceePCR595WS150 Sequence/Annotation Release
Overlaps_Gene Y105E8A.23 Source_evidenceePCR595WS150 Sequence/Annotation Release
Chunk_score Abs_score555
Max_abs_score555Y105E8A.23
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1455810214559317
Overlaps_transcriptY105E8A.23 Source_evidenceePCR595WS150 Sequence/Annotation Release
WB_DNA_textTH:154-b71216caattctttgcaatgtgcgtgtggaattttgagtcaatactatattatgatatgtagtttgtagtgtggtctcactgcattaacaagtcgtatttatacgctgatatctgatatccgcgagactcgaagtttttagatttttcaacaaaaaaaaatttgctcgatattcaaaaatgtatattttaaattccattaaatgcaaatttaccgcgtacttcaaatttaattttttaaatatgatttggcctcgatttcaattatatgcaaatataattgaattttgcctaaaaaggacataaatctttaatttttttagtacaataatctgactacaaactattgaaattcacaaaactatgcagtatgtatcctttttaatgcaactattgcttttaacaataaaaattcccatatttctacatttctacctcattttaatcgcctcggccttctttttcgcataacttcgaaacttttcaacatctacatcctcttttttgattccaattccaaattctctgccaaaatccggaatatcaaaagtatcatgtctcataggaatctccaacttctccaaaagacctctagattccgagtttccagatctaccgaatacatctttcagcacatccagcattggttcattaataacccaaggcgtcgatcccagttgattaagtgcatcaaaaaccggccgtgcttgtgcttgactcgtaattcttgctctcatctcttcattcaaccgtaccgcccggaattccatcattttccggataatctcgtgctgtgaagtagtatacaatggaccgcccgtacctctatcaatccatggacgtggtggaacgatcattgggaggtttgaagtggagaaaacgatgaaattgaatggatttttgtcgaataatcccattaatttcgaatttatcgataacattcttgatagtgatagacgtccgtctgtcgagacttttgattcttcttctattgatattgaacggtatgagaaggcacgttgccacgtcactgtaataatatttgtctcataagttttttcagaatcccgaaaaaaaatccgaacatttaaaaatttctaaaaaaaaaagtcaattttttcctaatttttttggatttttttcaaaaaatttcaaatttgttcggttctttctaaatttttttccaattttttccaaaatttacgtttcggtttcgaactgtt