Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:154-d3   

Cenix:154-d3RNAiCenix:154-d3
PCR_productcenix:154-d3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY75B7AL.4 Source_evidenceePCR613WS150 Sequence/Annotation Release
Overlaps_Gene Y75B7AL.4 Source_evidenceePCR613WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV13776581378277
Overlaps_transcriptY75B7AL.4 Source_evidenceePCR613WS150 Sequence/Annotation Release
WB_DNA_textTH:154-d3620tatttaccgtcggcgtatccatcaccattggcgacgttgccatgtcacagaattgcttcatcctcttcacatcgttcaaatcctttctcaacacgactttcggcgtgttttttggcgtcgtcgtcgtgtgtggcgacgactcttctttcaacacatccatcgccaccagtggatctgctttcagcacatccgtcgtcgattccacagccatcatcgatccattgagcaccatcatactttccgtgctgatatttctcatcgcggtggtggtggtggtggcggccttgttcttccttcccgctcgccgtgacctcgcttccagtgccttctgctccagcagccactccgaatgatccacattgttcgttgcatccagggtgtcatcagtcgtctcctcgcagtccgcctgattctccttctcctccagcgatgagccgccatcttttcgatgtggcaggccggcgcccacagtgttcggccgatttctgcggagcctattgttgttgatgggagccgtgtgacgtcggtttgtgagcttagaggacctcgacttctcgcccaatatcactgtattgcgtttctggattttacattctcgctcacgttgatgctcggatatg