Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:16-g1   

Cenix:16-g1RNAiCenix:16-g1
PCR_productcenix:16-g1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF25E2.2 Source_evidenceePCR894WS150 Sequence/Annotation Release
Overlaps_Gene F25E2.2 Source_evidenceePCR894WS150 Sequence/Annotation Release
Chunk_score Abs_score831
Max_abs_score831F25E2.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX807220808910
Overlaps_transcriptF25E2.2 Source_evidenceePCR894WS150 Sequence/Annotation Release
WB_DNA_textTH:16-g11691aaatatcgcacgtttttgggcacaacgctctcacaatttttctattaaactctttctgatcttcacatttacaatggtgatgagggtgttttgcacatttttcacacttggagtgagagcacttttcacaagatttcgagtttattgggcaatcctgttctttgttttgttctttctggtgtgcaggttcttgttcttccaagctgaaattatttaaatttatcttgaaaaaaaaattcaaatcgtttttgatcggatgttattcttttgcaaaacggttaattacaaaaaattttgactacttccttttcttaccaaaaccaaattggaaatgctattgttaacagttttttgttgaaagaacttacaaaacatgatctatgaattccaacattctcgatctatttttcggattcgtcgagaacttcttcactgcttctttcaaaaactttgcattttctgcctccgtatggcaatagattcttaacttgtcacaatcttccacaaaatcggtgcacttcttcaaaggagcagcagttgtcgttgcaatggtagttggaattgaagtagtgctggttgtagttggggctggggtagttgtggtagtagttggtttttgagtagtagttggtgctggagttgtagtggttgttgtagtggttgttggcttaggagttgtggtagtagtggtggtagttgtaggtagaggtgttgttggaacttctcgttttacagaatttccctttccatctttccctgaatatttgccggtggaagtttttttgataatcatttttgtgcgcatgaatgaataatgttttttttttcaaaaactttacaagggacacttacactgctctaccaaaaaacactatcgatgtccgagattaagagtagtacatgttagaccaaaaataatcccactgaaaaaactcattagaatcaggtaagctatgtcacttttttccaaaaaaatttattttggatctacagtgaaaacttccaaaattcggacaccaatcaattataaattctaaacttttttctggctctaaaataacaatttcatctcataaaatacctgaaacaatattgctccactgctgtttagtcgctgtcaaccacttctccacttcttctcttgtcatcatttttacgatatacccagcagttccattcaaagcacaatgcacgtattggtctccaaattgttgaattgcatttaccgttatcatttcctttgaataaatacacccgacttgtgtccacttaaactcgacagttccatctcgattaatgctaaacccacaggattccaggcggtctccgtttctagcacgattttcaaattggatgatatcgccggatgttgttgtgcagccctctcaaagttaaagattttggttttataattattaccaatcattttcaataactcggtagattcttttaatgaaatttcctatttttcaatatagttagattcataaaaccaacgtcgtataaagcgaaatgtatttgtattgaaataaaaatacagaaaataaccacgttttaaagtgattaccgacataaaatcattatcgagttccaacctgtatatagtctgttctatgtgatatgtctaccccgcttgtgcagtgtagggtgagttcttgtgtgtagcattttagcctctatgcctagccaca