Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:160-a4   

Cenix:160-a4RNAiCenix:160-a4
PCR_productcenix:160-a4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF10C2.6 Source_evidenceePCR1009WS150 Sequence/Annotation Release
Overlaps_Gene F10C2.6 Source_evidenceePCR1009WS150 Sequence/Annotation Release
Chunk_score Abs_score905
Max_abs_score905F10C2.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1205132712052867
Overlaps_transcriptF10C2.6 Source_evidenceePCR1009WS150 Sequence/Annotation Release
WB_DNA_textTH:160-a41541attgcagaatgatatccgccagaaatgtcacagctatttgctgtcgaaggatattatcaacttcatcttatacagtcagaacacatatatgtgatgagcttagtacttcgaataaaagtaaatagaaacaattattgttccttataaaaatctgaatttagatgaaaaagtgagtgtaatgggatggctatcccacaaacgtatggatcgatttttcgttttacgcgatgcttatggttcggttcaagcgaaaatatcagcatcttcgaagctgcagagccttttaaaggatattccctatgaatcagttgttcgagttgatggaattgttgttgatcgtggagataatcgtaacagtaaaatgaaaaccggagacattgaagtaaattttcaaaaatattattttaaaagtggaaataatgaaaattctaacagggaagtgtttgattttttgattctggttaattttctatttgaattacctctaacataagaaaccacgacggctttcgaaccaatcattttcttcgaattccgttcacttcatctgattggttcaaaaatggacgtaacgaatcgctggttgatcttgtatttagcgttcattttggagaaagttcaaacagggagattagccaaagtttaaaaatcgcgttattaaatgttgaattttttctagatttccttttgtggttttccaaaattttatgctattttttggatactttgaagcaaaatatctattacattttaaaataatttttgttggcagatcgatgttgaagaactgacagtactcaataaagctacttcaaatattcctatgctaccggatgccaatgcaaatgaaagaactcggttaaaatatagatacattgatttgagatctgataaattacaaaagtacatattacaatttttatatctattttgaaaaattacgaatttcaggagtttacgacttcgttcagaatttgtgcacaatgttcggaggtttctcgttgaaaaaagtggatttgtagatgttgaaacaccaactctatttcgtcgtactccaggtggagctgcagaatttgttgttccagcaccttctccaaaccagggacttgcctattcattgcctcaaagtccacaacaatttaaacagcttttgatggttggagctatcgatagatattttcaggttagtgagattttatttcgtaaacaataattttgattccagattgcccgatgttatcgtgatgaaggatcaaaaggtgataggcagcctgaatttacacaagttgatgtggaaatgtcatttacaacacaaaatggagttatgcaacttattgaagatatgattatatctgcatggccggagagtttgaaccatattaaacctaaatccccgtttccaagaataccgtattctgatgcaatgagactctatggaattgataaaccagatatgcgaattccgtggcaaattgatgacgttgataacgatatatttgaatttttgcaaaaagatattgatgatgatacttggcggtcaa