Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:160-g10   

Cenix:160-g10RNAiCenix:160-g10
PCR_productcenix:160-g10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF21A3.7 Source_evidenceePCR528WS150 Sequence/Annotation Release
Overlaps_Gene F21A3.7 Source_evidenceePCR528WS150 Sequence/Annotation Release
Chunk_score Abs_score486
Max_abs_score486F21A3.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1551720315518079
Overlaps_transcriptF21A3.7 Source_evidenceePCR528WS150 Sequence/Annotation Release
WB_DNA_textTH:160-g10877ctgcgtaaatcgacacatgggcgtgttcgaggttccacccgactcacctagcaattttactgggcgatatgtcaaatgagagccacttcaaataccacggaacattcattttgacccgcgactctcgttccaagtacacgaacattgacgtggtgactgtcgacattccgatgatggctaataatatgaaatagtagagtccaatcaacggaataccagaaaacgatccacgaccccgacgattcgttcccatcgagaatttcggcatatcttcgacgatggcgagcaagatgacagacatactcataagggtcatgattccaagtcggaattttgcgtctctggaaaaaaataaaaatatattactgaatgcttcaaaaaaaatcgattttttcctggcctggcacataaaaacttttttattaccgtagccactagtacggtagctgagaaagtttctaacctagatttttttcttcgaaaactaggccacctctcacctcattcttccacttgtgctgggtgtatgaaatccgatgactgataccaatgtgatcatagtactaggaattactaagttgaatactgaaaacatctcgattaaaaaaaataaattcaagccaaaatcccctcaccataataaaaactttgtcttttcataaccaacgtgataatgatcatttcccaaaataacggtggatccagataatcatacaaaaaaccatcggaatgcactgaactattgtgcgtgtcaagctcccattcctgattgtcgtaaaaatcgatgagcgataggttttgcgagtacaacgagtacttaatcgagtcgttcgagtgagcccacgagccgaagagcagcgagcattgttgtctgaaa