Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:166-c4   

Cenix:166-c4RNAiCenix:166-c4
PCR_productcenix:166-c4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F43E2.7a Source_evidenceePCR688WS150 Sequence/Annotation Release
F43E2.7b Source_evidenceePCR67WS150 Sequence/Annotation Release
Overlaps_Gene F43E2.7 Source_evidenceePCR850WS150 Sequence/Annotation Release
Chunk_score Abs_score703
Max_abs_score703F43E2.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII73729647374004
Overlaps_transcript F43E2.7a Source_evidenceePCR688WS150 Sequence/Annotation Release
F43E2.7b Source_evidenceePCR850WS150 Sequence/Annotation Release
WB_DNA_textTH:166-c41041gccagttgttgaaggatggtgaatatgggaggaacgaaacggctagtcctgaaataatcttttattttaaaagatactgttattcgcatgcttacctgatccagcaacagccataacagtggatacaacactgtatgggtagccgaaggagttgacgaggaatggaacagcagtatggatgaacttgtgaacatccttggcagccttggctttcgtttcgtccttattctttgtgtctccaaattcaatgcggagaatagctctttgaattccgtgagtaattagatgaactccccaaatgacgagaagctctccaacgatctgaggagcaagtccgctgaaaagtcctcctggaccttcctgctttccgatgacggccagagcctgggcgcaggtagtgtatttagtttcattgccaataacttgagcaacttgacgagcaaagcagactggaagagattattatacagtttaatcgcaaataatttaacttaccagcaaatggtcgtgcagcagtaacagcaacaacacgaatgacagaatcgcggaatccgttacgaataactcttcggaatgattcagcatcggtgagttcatcctcttctttatcttgatttaaaagaggtcctccaatattggggtagtactcgtcgatgtactgtaagataattttttacggttttcaggaactttcaatgagaaaactgtttacctgctgagtgcggtgagaagcaataccctgaacagccaaagcagcgatagcagagtcgattccagtccaaagggtgatatatccacgagtagttcccaattgcttcactaaatttatgatcattaccgaagattattttcgtgaatcctactatagctgaagaagttaggaaggaaatacgcatttcttcctgcaatgacgagagtctttcctgtagacaatgggaacggttcatgaccaagctggataagggtacgtgtcacggtcaaaggaagcgacaacgagctcaaagcgagcttggcaataagactcttggcgaatttctcctg