Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:168-h9   

Cenix:168-h9RNAiCenix:168-h9
PCR_productcenix:168-h9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY39B6A.36 Source_evidenceePCR434WS150 Sequence/Annotation Release
Overlaps_Gene Y39B6A.36 Source_evidenceePCR434WS150 Sequence/Annotation Release
Chunk_score Abs_score413
Max_abs_score413Y39B6A.36
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1899750118997934
Overlaps_transcriptY39B6A.36 Source_evidenceePCR434WS150 Sequence/Annotation Release
WB_DNA_textTH:168-h9434tcatcccaaaccaaaagagcccacagagggctcatcatctacagtaacccaaccagaagcctcggaaattccaacagaatactcatttattcttcatgacgtcaaatctcaaacaatgagcgttttatccgaagataagcagggactcggtgcagatgctccaatcaaaactggaaaactggcaattgagggacgaattatcaaaaaagcggaatgtcggccaccggccacgtcgaaatatatgaaaatgaagttggcacatattgtgaaaaatactcaaccaaagaaaacggttaaaatgattgaaaaagcggctgtgaagtttaagcccgtgtctgtacatgctgaagatatgattaagagcaaacagaagaaggatggagctaaaacttatcgagctgatagagatgtgctccgtggagctcttttcaaag