Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:171-c9   

Cenix:171-c9RNAiCenix:171-c9
PCR_productcenix:171-c9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY73F8A.24 Source_evidenceePCR318WS150 Sequence/Annotation Release
Overlaps_Gene Y73F8A.24 Source_evidenceePCR318WS150 Sequence/Annotation Release
Chunk_score Abs_score276
Max_abs_score276Y73F8A.24
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1544906415449451
Overlaps_transcriptY73F8A.24 Source_evidenceePCR318WS150 Sequence/Annotation Release
WB_DNA_textTH:171-c9388aataacgccgagctctctcaaatgattgagcagctcattctgtggctccgtccagttcgcatcgatttgataacattcccgttcggctttgaatcctgcaacttgtactagggaaggtgtgatattatgtgtgtggtgctctctttgagctgctgagttctatacctctattcgccaagagcacaatttgtatcaatggctcaataacttcgacaatatcctgtccttggctcatttctagttttaaatattcgataacatatgtccacatttgtttgacagggcttaaaaggagaaattgaaaaccaaaagtggtgatttcgatttgtgtatcaccaccacttgtgaaattggcttttttgaataaatttctggtggtttcggagac