Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:172-d3   

Cenix:172-d3RNAiCenix:172-d3
PCR_productcenix:172-d3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC204.6 Source_evidenceePCR383WS150 Sequence/Annotation Release
Overlaps_Gene ZC204.6 Source_evidenceePCR383WS150 Sequence/Annotation Release
Chunk_score Abs_score341
Max_abs_score341ZC204.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII16443821645031
Overlaps_transcriptZC204.6 Source_evidenceePCR383WS150 Sequence/Annotation Release
WB_DNA_textTH:172-d3650gccggttgactggtacacttgatactatgcccaaaacatcctgtcccagcggtgtaatcagtgttctcgggatctgaaacttgcttgaaacacaacaccaaacaccggttagaatagttgacttactcgcgaaaaagtcgggaagaggcttgcaaggacacttcaccgttggagttgtcgttggtgaaagagttgtcgtgttctcccgagccacacgaatgtgctcaccttgcaagacagcaaccggtagaattcgctcttcgagattcttcttctcggttgtggtggaaggtgggacagtggagacttcagtcgttgtggtggaaggtgggacagtggagacttcagtcgttgtagccgaatcaccggctggtagtccgcatccgcagaatatcgagttgattgatagcgacaatacgaagattgtcttgatcatgagttttgtcggtcgaaaaatgaactaactgattgaaattgtggcttttatggcagtgcttgatatgctaatgagacagcaagagaatttaaatgagatggtaattgggggttgccttgaacgatcagttcagctctgcaaaatacggaggggattcgtaccccagcgcaccccaatccaaagctcaacaggctccgtgagtcctgagttggtt