Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:176-b11   

Cenix:176-b11RNAiCenix:176-b11
PCR_productcenix:176-b11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T19E7.1 Source_evidenceePCR497WS150 Sequence/Annotation Release
T19E7.2a Source_evidenceePCR11WS150 Sequence/Annotation Release
Overlaps_Gene T19E7.1 Source_evidenceePCR497WS150 Sequence/Annotation Release
Chunk_score Abs_score434
Max_abs_score434T19E7.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV56538515654897
T19E7.2 Source_evidenceePCR11WS150 Sequence/Annotation Release
Overlaps_transcript (8)
WB_DNA_textTH:176-b111047gcagtgagtggctgaaatgatagaaattgtttaaaatttatttgctgagaaatttgacaccatcatctctatgattgttttccattcaatcagcttcccccaatcattcctcaactcaaccatgattcttcttctcctataccttctcattccaactatcaataccgtagtcattcctagccctctaaaatcttcatatcaatctattgctggacaacgtgcaataaatctcgatgtcaacgtgcgtctactgactgtgttagctcttcaacaaagtgtaagttatccatgtacttacgcaataggtatattccctaaagagttcgtccctgtctatgacgcatctcgtctaagagtttccaactgatagctcaaagtctacttacgtgctctttttgacctacaaaatactcaatatctataaaagtacgtcagagcggcgggtcgttgaattgtcatcatcgaacgttgctctggaaaatcgaaacaacgccctccaccgggtcgaaacgaatcctagaagttttacgctgcgataaggtatcaagagagagacaaacaatgaaaaataaaaatgacggcaaccaggataaggcgtgcgaaaagactgctcggctcgttatcgtaatacagactaacacgaaaagtgacgccgattgcagggctggcaactatacgaagatcactggtataagatgtttgaaaccgacgtaatgtggattccagcagaaaatgtgtgtagatcaatgggagggcacttggttagcatcaaggatgaatccgaaaacctatttgtacacaaactaagaaagagtgagatatatcctttttctaattgaaattcattactactacagagaacaatatttggattggcctcaacaagctaaatgatacattccacgtgtacaagtggtctgatggttcggaagccgattatctcaactgggcatcttcacagccaaatgagccagatgttgattgtgcctacatggcatttcatcaagaacaaagaggcacttggtttgattacggttgccgtgaaat