Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:178-d3   

Cenix:178-d3RNAiCenix:178-d3
PCR_productcenix:178-d3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y54F10AM.5 Source_evidenceePCR436WS150 Sequence/Annotation Release
Chunk_score Abs_score373
Max_abs_score373Y54F10AM.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII25287412529635
Overlaps_transcript Y54F10AM.5.2 Source_evidenceePCR430WS150 Sequence/Annotation Release
Y54F10AM.5.1 Source_evidenceePCR436WS150 Sequence/Annotation Release
WB_DNA_textTH:178-d3895caagaaaagggcaaagttcgatagcccgtaaatcgacatgagatgccgcgggtctcgcagggaagagagccaacatggcatgcgcctttaaacttgtgtggatttacgggcaaacagccgttgcgcaaaacaaattttattttttattttatcatttaaaatcaaaataaactattttcaatcgatttttttttgtttttttttgtttaaaaatcaaatttcaaatttttctcatcgaaaataataaatttcatcaccgaattccctctctgtaacagtttccgcttggtttccaattttccaatttcagggtacattttccgatgagtataaccaaggatacgcattttccaagtgacgaggagctcactgttcctcaggaaatcactttatcaactccatggctcaaatccatcgctccctatatggcaaaacattgcgaaaaggaggcaaatgttggtttttctgccaaattttcgataaaattgagattttttgcaggagttcatgcttcgacgaaaggaagccgaggatccacgtgccgttttgaaggagggagccgcgctgaccgcgtgtggagtcaattttcttcaatctttgaagcgttcctgccttccacagactcagaagctcgccgaatgtgttgatcagagcagtgccaagctttacatgtcaaagtgagctttccaaaaatgaaatttcatcgaaaataaaccgttaaaaaattttaacgtgatttttttccgaaaaaaaaagcgaaaaagcagtagaatattcaattttcaggtgccatgacgaccagaaggagctcgatgcctgcgtggaagctaatttgaacttgacgcgtccaaagcttggatacttcagcaaacttcatgtctatgactcggccacc