Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:178-h11   

Cenix:178-h11RNAiCenix:178-h11
PCR_productcenix:178-h11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y71H2AM.15a Source_evidenceePCR478WS150 Sequence/Annotation Release
Y71H2AM.15b Source_evidenceePCR478WS150 Sequence/Annotation Release
Overlaps_Gene Y71H2AM.15 Source_evidenceePCR478WS150 Sequence/Annotation Release
Chunk_score Abs_score396
Max_abs_score396Y71H2AM.15
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII27484502749349
Overlaps_transcript Y71H2AM.15b Source_evidenceePCR478WS150 Sequence/Annotation Release
Y71H2AM.15a Source_evidenceePCR478WS150 Sequence/Annotation Release
WB_DNA_textTH:178-h11900cgaaacatgatgcatcgaactaaaattgacacaacttctcgtaatttccgtagaaaatcagaataaaaactgttagcaggttaaaagggtaagttgttttatcaacttccagaaaaaaccttacttttcaagttcgctgcaagtcgtccaatattcgttagtttttcggtcatatcttccacttcgctcattcgtagctttttctgatttgcaagcacactaccacgtacggtttccacatttgtctcgaaacttctgcaaacaaaaaattggttaaaatgttgaattttggtatcatggtgaatcggaaaatattttagaaaaatatttagtttttttcgttctttccagaagtttctagatttttctgaaaattccaaaaaaattatctttcttccgaaaaattctaaacctttccagaagttttccgcgacggagccaacctcgtcatttgctaaacacttacgtcaatgaatgtagaagctctgcaagttgactggcatgctcatttcgttggctctcgttgctcatttccgtagctggaatctcaattggcatgactgaaaccccaccacgcattctatcagcaaccaatcttccgatcttatccccggcttctcgtaaaagcgtatttccagtctgagcattcacctgcaaaatttccattattttcatttgagctcctactaatcaatataacctgtgcagagtttttgagctgtttcagctcattgtgagtgtctttaagcttgctacggaacacggagagttgataagcggtgtgtgaggaaattgagtcggatagagaagaggctggtttttcggaagattctcgagcagtgtcagggtgcatggataggatctggagttaatgtttgataaggagattagctgaggggg