Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:18-a5   

Cenix:18-a5RNAiCenix:18-a5
PCR_productcenix:18-a5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F26D11.11a Source_evidenceePCR567WS150 Sequence/Annotation Release
F26D11.11b Source_evidenceePCR567WS150 Sequence/Annotation Release
Overlaps_Gene F26D11.11 Source_evidenceePCR567WS150 Sequence/Annotation Release
Chunk_score Abs_score506
Max_abs_score506F26D11.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV79792757979891
Overlaps_transcript F26D11.11b Source_evidenceePCR567WS150 Sequence/Annotation Release
F26D11.11a Source_evidenceePCR567WS150 Sequence/Annotation Release
WB_DNA_textTH:18-a5617tcgagcattctacagccagagatactatcaggaaggcttgttagactgtttatgtcgacataaaactctcgtagacttgtgagttttcctatttcagccggcagtgcttcaagttcattttgtccaagatcgagctcttcaagttttctcaattccacaatcgacagaggaattgttcggagaagattgtctcgagcttcgagaactcgcagattcgtcagagatccaatgttagatggtaggagtgtcagacttgtctcgtttaaagacagaatagtgattgatgagcattcgcatatagtttcaggtaatctgaagtcaaaaaatgtttgaaaattattgaataatacaaatacttaccttgtgaacggattactgctcaagttcagcgttgtgagcaatttacaattttgcatggtatctggtagttttgcgatgctatttctattcaagttcagctcaataagttgagttagatttccaatttctgcgggtaaaactgccaactcgttatcggaaacatcgagaattcgaagatgtcgaagagagaataggcgatggtctaactccttgatgttattcattgttagattcagatcttcgagtttgcgaaacct