Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:181-e5   

Cenix:181-e5RNAiCenix:181-e5
PCR_productcenix:181-e5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC06G3.2 Source_evidenceePCR115WS150 Sequence/Annotation Release
Overlaps_Gene C06G3.2 Source_evidenceePCR115WS150 Sequence/Annotation Release
Chunk_score Abs_score94
Max_abs_score94C06G3.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV70423207042434
Overlaps_transcriptC06G3.2 Source_evidenceePCR115WS150 Sequence/Annotation Release
WB_DNA_textTH:181-e5115cgaaaggaaagcatctgacgagtatgctgctcttcgtgaggagttgaatcaaaagacgctgtcttcaaatttactccaagttcaagtcgacgagctccaactttcaaatgccaca