Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:181-h4   

Cenix:181-h4RNAiCenix:181-h4
PCR_productcenix:181-h4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC05D11.10 Source_evidenceePCR135WS150 Sequence/Annotation Release
Overlaps_Gene C05D11.10 (3)
Overlaps_transcriptC05D11.10 Source_evidenceePCR135WS150 Sequence/Annotation Release
WB_DNA_textTH:181-h4135gtcctgtgactggatcgacaatgtttccgaatttaaacactacacggtcaacagcatgagagacgttggcctttgggcgggaagaaccatcgatctgcttgatgagcactgtatctccgatgtttccaagtgatg