Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:185-e5   

Cenix:185-e5RNAiCenix:185-e5
PCR_productcenix:185-e5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF56C11.5 Source_evidenceePCR150WS150 Sequence/Annotation Release
Overlaps_Gene F56C11.5 Source_evidenceePCR150WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRI181337181486
Overlaps_transcriptF56C11.5 Source_evidenceePCR150WS150 Sequence/Annotation Release
WB_DNA_textTH:185-e5150tttcgtcgcgattttctaccaaatcggaaatcttctcatcccgcacatcgtcatgcagattctgctcgttttgtgcttcctgggactcacatgtgcgacgctttatgcgcttttccacggtgccacgtttcagttgctcgtcgtggttac