Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:186-e7   

Cenix:186-e7RNAiCenix:186-e7
PCR_productcenix:186-e7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSM7.1 Source_evidenceePCR106WS150 Sequence/Annotation Release
Overlaps_Gene M7.1 Source_evidenceePCR106WS150 Sequence/Annotation Release
Chunk_score Abs_score66
Max_abs_score66M7.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1108178011081894
Overlaps_transcriptM7.1 Source_evidenceePCR106WS150 Sequence/Annotation Release
WB_DNA_textTH:186-e7115cctttcgaaatggtcagagccggcgaccactgcgaacggagaatgtcaaggcagatgcttccgtttgaattgatgttcggatgataaattcgagtggtgaaggcaacctgaagaa