Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:187-g9   

Cenix:187-g9RNAiCenix:187-g9
PCR_productcenix:187-g9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST23D5.11 Source_evidenceePCR139WS150 Sequence/Annotation Release
Overlaps_Gene T23D5.11 Source_evidenceePCR139WS150 Sequence/Annotation Release
Chunk_score Abs_score118
Max_abs_score118T23D5.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1575880215758940
Overlaps_transcriptT23D5.11 Source_evidenceePCR139WS150 Sequence/Annotation Release
WB_DNA_textTH:187-g9139tttctgagtatggaagggcgctgaaaagtaagaactgtaacctgattgtgataaagttgaaaggttctaactttcttacagaagtgtataggaatgcgaagaaattttgtgctgtgaaaattccgaaagacgtcagcaa