Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:188-c4   

Cenix:188-c4RNAiCenix:188-c4
PCR_productcenix:188-c4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS W07E11.3a Source_evidenceePCR141WS150 Sequence/Annotation Release
W07E11.3b Source_evidenceePCR79WS150 Sequence/Annotation Release
Overlaps_Gene W07E11.3 Source_evidenceePCR141WS150 Sequence/Annotation Release
Chunk_score Abs_score120
Max_abs_score120W07E11.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX1009486010095000
Overlaps_transcript W07E11.3a Source_evidenceePCR141WS150 Sequence/Annotation Release
W07E11.3b Source_evidenceePCR79WS150 Sequence/Annotation Release
WB_DNA_textTH:188-c4141gaagacgttttgccattgctgaagcttcgaaaattccaagagtgttgtcgttgacagctggctgggcgacagtagtaccctttaaataagctagttggccacgtaataactgatcccgactagtgggaatggggagtatcc