Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:19-e10   

Cenix:19-e10RNAiCenix:19-e10
PCR_productcenix:19-e10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F01G10.1 Source_evidenceePCR511WS150 Sequence/Annotation Release
Chunk_score Abs_score457
Max_abs_score457F01G10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1024393610244492
Overlaps_transcript F01G10.1.1 Source_evidenceePCR511WS150 Sequence/Annotation Release
F01G10.1.2 Source_evidenceePCR511WS150 Sequence/Annotation Release
WB_DNA_textTH:19-e10557actcggacatcgaaggacaccccactcctcgcttgaacttcatcgatgttgctacaggatctctcggacaaggacttggagttgccactggcatggcttacgtcggaaagtacattgacaaagccagctaccgcgtcttctgccttctcggagatggtgaatctgctgaaggatctgtctgggaagctgctgcttttgcttcaatctacaagctcgacaatctcgttgctattgtcgatgtcaacagactgggacaaagtcaagccacttctcttggacatgacgtagagacctacaaagctcgctttgccgctttcggattcaatgccattattgtcaacggacacaatgttgatgagctcttggccgcatatgagactgctcgttccaccaagggaaagccaaccgccatcatcgccaagactttgaagggaaaaggaatcgaaggaattgaaaacgaggacaattggcatggaaagccagtcccagagggaacagtaagtttgacgtgagaatgaaatagtctcatattaaaaatttcaggtcaatgccatcaa