Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:191-a7   

Cenix:191-a7RNAiCenix:191-a7
PCR_productcenix:191-a7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y74C9A.2 Source_evidenceePCR111WS150 Sequence/Annotation Release
Chunk_score Abs_score90
Max_abs_score90Y74C9A.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1493715061
Overlaps_transcript (5)
WB_DNA_textTH:191-a7125aacacaactttcagcggctccatcggctccggcaggtctcgaggagaagctgcgtgctcttcaggagcaactgtacagtctggagaaagagaacggagttgatgtgaagcaaaaggagcaaccag