Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:191-h4   

Cenix:191-h4RNAiCenix:191-h4
PCR_productcenix:191-h4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y71F9AM.5 (3)
Y71F9AM.6 Source_evidenceePCR108WS150 Sequence/Annotation Release
Chunk_score Abs_score87
Max_abs_score87Y71F9AM.6
Specificity_index0.5
Map_statusBest_ePCRI29299822930131
Overlaps_transcript Y71F9AM.5.1 Source_evidenceePCR108WS150 Sequence/Annotation Release
Y71F9AM.5.2 Source_evidenceePCR108WS150 Sequence/Annotation Release
Y71F9AM.6.2 Source_evidenceePCR108WS150 Sequence/Annotation Release
WB_DNA_textTH:191-h4150ttacgatgtgatggaccgaaaacgcgagaaaatcggatttctctacacacaagtgtcaaatgccgtctggaacgggaatcccatcaacgggtacgacagtatttgcgagtaagtttcgaaaatttcgaaatttttgcaatttctttcgca