Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:193-b8   

Cenix:193-b8RNAiCenix:193-b8
PCR_productcenix:193-b8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C31E10.7 Source_evidenceePCR115WS150 Sequence/Annotation Release
Chunk_score Abs_score94
Max_abs_score94C31E10.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX1400183314001957
Overlaps_transcript C31E10.7.1 Source_evidenceePCR115WS150 Sequence/Annotation Release
C31E10.7.2 Source_evidenceePCR112WS150 Sequence/Annotation Release
WB_DNA_textTH:193-b8125aatgattttcagaatggccgatcttaagcaaatcacccttaaggaaattgccgagcacaacacaaacaaatcagcatggcttgtaattggaaacaaggtgtttgatgtgaccaagttcttggacg