Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:198-d4   

Cenix:198-d4RNAiCenix:198-d4
PCR_productcenix:198-d4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS H31G24.4 Source_evidenceePCR148WS150 Sequence/Annotation Release
Y43E12A.1 Source_evidenceePCR148WS150 Sequence/Annotation Release
Overlaps_Gene H31G24.4 Source_evidenceePCR148WS150 Sequence/Annotation Release
Chunk_score Abs_score106
Specificity_index0.455
Rel_score0.835
Map_statusBest_ePCRI41151354115282
Y43E12A.1 Source_evidenceePCR148WS150 Sequence/Annotation Release
Chunk_score Abs_score127
Max_abs_score127Y43E12A.1
Specificity_index0.545
Rel_score1
Map_statusBest_ePCRIV1098616210986309
Overlaps_transcript H31G24.4 Source_evidenceePCR148WS150 Sequence/Annotation Release
Y43E12A.1 Source_evidenceePCR148WS150 Sequence/Annotation Release
WB_DNA_text TH:198-d4_1148gcatccttgttgactggcttatccaagttcatcttcgcttccacctcacccctgagacgcttcacctgacgattttcgttctggatcgaattatcgtgaagaacattgtctccaaggcggaattccagcttctcggtgttgcagcttt
TH:198-d4_2148gcatccttgttgactggcttgtccaagttcatcttcgcttccacctcacccctgagacgcttcacctgacgattttcgttctggatcgaattatcgtgaagaacattgtctccaaggcggaattccagcttctcggtgttgcagcttt