Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:200-b9   

Cenix:200-b9RNAiCenix:200-b9
PCR_productcenix:200-b9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T19E10.1a Source_evidenceePCR800WS150 Sequence/Annotation Release
T19E10.1b Source_evidenceePCR824WS150 Sequence/Annotation Release
Overlaps_Gene T19E10.1 Source_evidenceePCR824WS150 Sequence/Annotation Release
Chunk_score Abs_score719
Max_abs_score719T19E10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1077936110780471
Overlaps_transcript T19E10.1a Source_evidenceePCR800WS150 Sequence/Annotation Release
T19E10.1b Source_evidenceePCR824WS150 Sequence/Annotation Release
WB_DNA_textTH:200-b91111tctccgataaatctgtggggtgcattgacgtaccgaattcctcgctttggcgtcgattcagattcgctttggcatccaggcaatccgccgactgacgtcatgtttgcgagagctgctggatcacacgaaactctgggagactgcagaaatgtcgtgttctcgtctgaaattagtgaatcaaatacaatttcagaagaaaaaaaaataaattttctaaaaacgcactaatttgtcccaagttatttcgactctgatttctgccaaagcccagcgtggtggcaagtgtgagttgagcattactgaacgctcgtcgcattcgactctgtgactgtggtggtggcataaacgactcattgtgtgaccattcctgtaataaaagtttatatataagcattcaagttaggtgtaacactgtggacaattttaatttctccactcatgtatcaaacttcatttctcacgttttgtgtagatcgttcactgaccgtaatgttcatctgactgccgtgtccatattgtggtttcgctccgcaaagactgaaattttgattttttctaaagacttgaaacctgaaataagcctactttctaaagtatcgagttgtcatatccgaaaccatcgcatcgttgatctcattcatatctgatggatccgacgagtagaagaatctcccacaatcactcaagatcttcacatgaatatcgtcgagaaaatctcgaacctcttcatcatcattcgattcgaagactgtgtcaatgtcaccaccttgctcgtcacgatgaatcaggcaccatacaaacacatttggctttgtgcttccgttctgctgctgcaactccagacacttcgcaatctcgtcgggagcacgaattcggaatgcactacgcatcgtgttcaactgtatctggtcaatgtacctgtaggggcgacgctgtctcgaatgtaaactggcaaacgacgcgtgacgagctagacgttgcattgtattcttctcgctgcgtattttcgtgatctgaaatttcagaattattattcaaaataattatttaaagactctcttacaattagcacgtcatgaaataaaaataatttcattttcgcaaactgctg