Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:201-b11   

Cenix:201-b11RNAiCenix:201-b11
PCR_productcenix:201-b11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF54C9.4 Source_evidenceePCR864WS150 Sequence/Annotation Release
Overlaps_Gene (7)
Overlaps_transcriptF54C9.4 Source_evidenceePCR891WS150 Sequence/Annotation Release
WB_DNA_textTH:201-b111174attcgcggatcaactcattcgtagccataatcaaaatttgaaatataagattttatttgaaattaaatcaaaataaaataatttagtgcttcttggctctagctgggcatgggcaatagttagcatctggtccaatagatccatcctttcctggcaatcctggttgtccattatcagcatcacgtcctggttgtccatctggtccctgtggtccttgtggtccttgctctccatcaactccagaatctccgttctttcctggttctccttgagatcctggccatcctggagttcctggttgtcctggaagtcctggtcctccaatagttccatcttgtccagttggtccttcagatccttcagttcctggctctccttgtggtccttgttctccagtgattccggcctctcctggagctccatcttctccacattgtcctgcagatccagatgctcctgggaatcctggctctccaatatctccgtctggtccagtttctcctggtggtccttgtgggcattgaatgcatcctcctggaagatgatgggtaacagccagagatactccagaagctccatcacgtcccttatctccagatggtccttgatctccacgtcctcctggaagtcctggtggtcctggtggtcctggtgggcatccttgagagttggcatcacaattacattgagatggataagcagaacgcttgttacggaaaacgctggcgaaagcggcactgcgggattcagaatcaagagatggcttggtgaatccaatcatacgattccatgcatcatcagacatcacctgaaaacagttttttataggcatatccagttgaatcctttcggagtccaagttgactataactcatagatttataaaaaactaatactttaaatataaatactaacaggtttatcataattaccaaccttcatgtcatggactccagttacaatttcttctctcatcgtgtcaatatcgacaacaatggaatgcatggcgacaagggcgccaaaaacggcaaccagcgaaatagaagcacaaacgggaaccaaatattttgacatttttagacgatgtctgagtgttccatcaggaaacgattcattttaatagtgaagacgttcgtggtgagatataatgtgaacttgagagagatgcgtgacg