Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:201-c1   

Cenix:201-c1RNAiCenix:201-c1
PCR_productcenix:201-c1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C09D8.1a Source_evidenceePCR1578WS150 Sequence/Annotation Release
C09D8.1b Source_evidenceePCR1578WS150 Sequence/Annotation Release
C09D8.1c Source_evidenceePCR1578WS150 Sequence/Annotation Release
Overlaps_Gene C09D8.1 Source_evidenceePCR1578WS150 Sequence/Annotation Release
Chunk_score Abs_score1536
Max_abs_score1536C09D8.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1100908711010760
Overlaps_transcript C09D8.1b Source_evidenceePCR1578WS150 Sequence/Annotation Release
C09D8.1a Source_evidenceePCR1578WS150 Sequence/Annotation Release
C09D8.1c Source_evidenceePCR1578WS150 Sequence/Annotation Release
WB_DNA_textTH:201-c11674cattgcagttgtatgacgggttcaccaactacccactcgagcacaaccttcactaccgactgatgatgcgggcgtttgcgaaaaatgatgtgcgaaccaaggacagtgtaagtttacttttcccgttttttttttcaagatagatcgacatcatttttaaatttgaatccaacttttttaattcgaaattttcagttcgaacaacgtgcaccaatgagcgagaagctgtcccgtatgtactctgattctgttctaactgagccattcacaatcaaatcggctcttcgcggagcttcgcagaagtcgtctccttgggttggagcgtgcatcgccttcttggtcttgttctcgattgttggaatgctgatatgttggtggttgcgttgcaataagaagtctgctggacggcatccacgacatggttctatcacaaaggttgcgttgactggaaatattatgaatggaggtggtggaatacctggagaaacaagcaagttattatcgacttccaatgaatacggacgacagattatgaacccctatgagcagatgaatggaaatcatcatatggaatcatcgatggatctttatcctttgccaacaagtcactctagatctaatggatatgcacctgttcctgtcgcaataccatctcttccaaataatggaaacaatatgactacagtatcccatccagctgttccgatagctgaacttgcgaatcatatcgagaggcttcgaatgaacaataatgcaggattccagtcagaatttgaatctattgaaactggacaacacttcacttgggaacactcgtctgctgatatgaataagcataagaatcgatacgcgaatgtggctgcctatgatcattccagagttgtactttccaatgttgaaggatatccaggaatggattacatcaacgcaaattatgtggatggatatgacaaaccaagaagctacattgccacccagggaccactcccggaaacattttcggatttctggagaatggtttgggaggagcaatcggttacaattgtgatgttaacaaatctggaggaacgaagtcgagtgaaatgtgatcaatactggccgagtcggggaactgccacatatggagatatcgaggtgacactgttggaaagcgttcatttggctcattatacgatgagaacgatgcgattgaaaatggttggagaacctgaagttcgagagatcaagcatctacagtatactgcatggccggatcatggagttcccgatcatccgacaccgtttttgatcttcctgaagagggtgaaaacgctgaatccaaacgatgcaggaccaatcatatcgcattgtagtgctggaattggaagaactggagccttcattgtgattgattgtatgctggaacgtctccgctacgacaatacagttgatatctatggatgtgttactgcgttgagagcacagaggagttatatggtacaaactgaagagcaatacatctttattcatgacgctgtccttgatgcggtgaacagtggatccacagaggttcctgccagtcggttgcatcaacatttgcacattctttcacaaccatcagctgatcaattgtctggaattgatatggaattcaggcatttgacgacactgaaatggaccagcaatcggtgtact