Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:202-c9   

Cenix:202-c9RNAiCenix:202-c9
PCR_productcenix:202-c9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0034.3a Source_evidenceePCR1098WS150 Sequence/Annotation Release
Overlaps_Gene B0034.3 Source_evidenceePCR1098WS150 Sequence/Annotation Release
Chunk_score Abs_score1015
Max_abs_score1015B0034.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII59543195955686
Overlaps_transcriptB0034.3a Source_evidenceePCR1098WS150 Sequence/Annotation Release
WB_DNA_textTH:202-c91368attcagcagcacggaagtctgaagtggctccagcttcacggcggagaacaacctccaatttgcagtgacgaatgtagacagagaagtgatgacggttcatgtctgaaaacacatattcactggttgtttctaaaagagataactcactgaaatcatcactttcgcaaagaatgttctgcttgttactttgctcgtccttagttcctgcagcatgtttcatggagaagctcaatgtgaagtgatccggaatgagtccttgatgattttcatcagagacagtcactcctctggctccatcaaactcaattccttgatcagcaagaatctgattctcagccgagctggtaagggcttcttcgttcagcaatttgacagtagcagttgaaagtccacaagattgaattgtctgattatcatagacagtgtctcttgcacaaccttgagtaacgtgtccagcacgaagttcaatgactgactgcacactctttggttcacaaattgtttccttttcacagaattcaagagatacgtctgggaggagaagctttgatccaactcctggagcatagttgacacgctcattcattgcagtgattccttgaacacatttctcatcaacgtgaacagtgaccagagaacttttgcttttcctcattgcgcagtcaatagcgactacagtgagaatgtatgattttgattgagtaaagttgagtggctgagttgtacgaaggactccatgattgttaatggcgaacggaagttccttaagtccatttgtgatctcatattcacagatttctccgtttggatgtccacagtctttgtcagatgccttcagtactccaacttcctcaacaacttttccctcttccacgtggaatgtgtaccaagggttttcgatttctggagcatgattgttggtgtccttgacacggatcttcagagacactccttcactcttcacattgtcgttatcgcatttcacagcttgaacttgaagattgtattctggcttcttgcagtctagtgtggcagcatcctgaataataaatgtttgaactttaatggtgactcatcaagaattaattttctttagaaatattgaataaagtttaatgaaaattccttctaagaacacattgatttttaagcttacaaaacggttttccactaattatctgatacacacgaattaaaatatgaatactggaattttcattagatgcctattctccaaaaatacattatgacatcatgtctcaccttaactcgaagtacagctgctccagtgtacttatcaacaacctggatgtcgaatggcactggctcattgttctgtgatgtaaggaggtagttgcatactggccc