Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:206-e1   

Cenix:206-e1RNAiCenix:206-e1
PCR_productcenix:206-e1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK05F1.2 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (14)
Overlaps_transcriptK05F1.2 Source_evidenceePCR442WS150 Sequence/Annotation Release
WB_DNA_textTH:206-e1678aaagttttcctagcgccctcttaatagttgaaactttgtaaaatatgttatgtctttgattttttcttattcaaaattacgcatttttgcgtgaaaaaaggttaaaaacccacgtggctaataaaattcctccctatataagctcgaagaattcataaaatcttcattgagtttttaaaaactcctacaagaagtcgccatggcccaatccgtcccaccaggagacatccagacccagccgggtacaaagattgtcttcaatgctccgtacgacgacaagcacacgtatcacatcaaagtgatcaattcgtcggcacgccgtattggatacggtatcaagaccaccaacatgaagagacttggagttgatccaccatgtggagttctcgacccaaaggaagcagtgcttctggcagtttcctgcgatgcatttgcttttggacaagaagacaccaacaacgaccgtatcaccgtcgaatggaccaacaccccggatggagctgccaagcagttccgccgcgagtggttccagggagatggtatggtccgtcgcaagaatctgccgatcgaatataacccatgagaacttctaaataaatattgttttacctcattgtttgttaatttttaggattaaaatacattatctgactagtagcccattctcccaatatggag