Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:206-e1   

Cenix:206-e1RNAiCenix:206-e1
PCR_productcenix:206-e1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK05F1.2 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene K05F1.2 Source_evidenceePCR442WS150 Sequence/Annotation Release
Chunk_score Abs_score400
Max_abs_score400K05F1.2
Specificity_index0.262
Rel_score1
Map_statusUnique_ePCRII57976945798371
ZK1251.6 Chunk_score Abs_score62
Specificity_index0.041
C09B9.6 Chunk_score Abs_score60
Specificity_index0.039
Rel_score0.15
ZK1248.6 Chunk_score Abs_score157
Specificity_index0.103
Rel_score0.393
ZK1248.17 Chunk_score Abs_score105
Specificity_index0.069
Rel_score0.263
F36H12.7 Chunk_score Abs_score62
Specificity_index0.041
F58A6.8 Chunk_score Abs_score79
Specificity_index0.052
Rel_score0.198
C34F11.4 Chunk_score Abs_score85
Specificity_index0.056
Rel_score0.212
K05F1.7 Chunk_score Abs_score139
Specificity_index0.091
Rel_score0.347
ZK1248.4 Chunk_score Abs_score84
Specificity_index0.055
Rel_score0.21
R13H9.4 Chunk_score Abs_score62
Specificity_index0.041
R05F9.8 Chunk_score Abs_score86
Specificity_index0.056
Rel_score0.215
ZK354.11 Chunk_score Abs_score62
Specificity_index0.041
Rel_score0.155
R05F9.13 Chunk_score Abs_score82
Specificity_index0.054
Rel_score0.205
Overlaps_transcriptK05F1.2 Source_evidenceePCR442WS150 Sequence/Annotation Release
WB_DNA_textTH:206-e1678aaagttttcctagcgccctcttaatagttgaaactttgtaaaatatgttatgtctttgattttttcttattcaaaattacgcatttttgcgtgaaaaaaggttaaaaacccacgtggctaataaaattcctccctatataagctcgaagaattcataaaatcttcattgagtttttaaaaactcctacaagaagtcgccatggcccaatccgtcccaccaggagacatccagacccagccgggtacaaagattgtcttcaatgctccgtacgacgacaagcacacgtatcacatcaaagtgatcaattcgtcggcacgccgtattggatacggtatcaagaccaccaacatgaagagacttggagttgatccaccatgtggagttctcgacccaaaggaagcagtgcttctggcagtttcctgcgatgcatttgcttttggacaagaagacaccaacaacgaccgtatcaccgtcgaatggaccaacaccccggatggagctgccaagcagttccgccgcgagtggttccagggagatggtatggtccgtcgcaagaatctgccgatcgaatataacccatgagaacttctaaataaatattgttttacctcattgtttgttaatttttaggattaaaatacattatctgactagtagcccattctcccaatatggag