Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:206-g9   

Cenix:206-g9RNAiCenix:206-g9
PCR_productcenix:206-g9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T19D12.4 Source_evidenceePCR55WS150 Sequence/Annotation Release
T19D12.5 Source_evidenceePCR1086WS150 Sequence/Annotation Release
Overlaps_Gene T19D12.4 Source_evidenceePCR55WS150 Sequence/Annotation Release
T19D12.5 Source_evidenceePCR1086WS150 Sequence/Annotation Release
Chunk_score Abs_score1002
Max_abs_score1002T19D12.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII66348236636205
Overlaps_transcript T19D12.4 Source_evidenceePCR55WS150 Sequence/Annotation Release
T19D12.5 Source_evidenceePCR1086WS150 Sequence/Annotation Release
WB_DNA_textTH:206-g91383cggcaaacttctggaacaataatctctatacagttgatcaaacgatgatgtcagggtaagaatcatttgctgtttgtgttctcttctgaaacttcatcttgtcctttgctgctttcttcccattcatatggatcagtcaagactttcggagcgtagagaactttgatgcattcaatcagtttctcgtagcaaggttctttcattggatccatttcagaaacctgcttgaagaagtcgataagaacacttttgtctccttggaacagctctggattgattccattttcagtctgaaagctcgtaatcttccaggcaaacggttttgtgtgtcgcttaccataacctccttcagctgtacaacttcttctgatttttcaagatgtttccatgggagttcaccagcaagaagttcgtaagcagtgtacataactgacacaagatcatcatacggtgattgctcgcaacggcggtgaactctgatagagacatagcgagtcgttccacgaaatcctgcgcgaagtctgggctctctccattctccactttccattttatatcttcgtacaagtccgaaatcaagaagaatcaatgtatgacgactctgaaaaataatgaatagttccccattacttggaaggttgattcatacatgaggaaaaattccaaagcacatgtttgctggcttcacatctctgtgaacatatcctgtttcgtgaagatcctgaagagcagcgataacctgatggatgattcgtccaactgaacattgactcaacttcttgttcggactgcttttcttgatatctccaacgttgatactcaagatttgcataactaaaagttaaattttagaattttcattctgaaaactgacttactgataaagttgtacttctccgcatgcccagatccataaatcatcggaacatgtggttttccttgcattttagccaaaacatgttgctccagaatcattctcttcgccagttttcctcttctcttcttcggttccactttaattgccacctcctctcctcgaacaacatccagtgccaaatatatctccccatatccaccttttccaatcaatccctcaatcaaccatctcttcataaatttctcgttcaacggcaaatgtcctggctcttctggatcaattttcttcattttcggcaagacttctttattgacaaacatcgtcttctcaacggtttttggatttaatgccattggtgtcgttgttacaggtgttggagcattatcttcttgtttcgtatccttcgacattatcttcttgtgatcttttttgttaatatttcgcaattcgaaacaaaaccatgaaatgattgaaattatcgaaaatcggaaaaagtagaaaacgcg