Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:207-b6   

Cenix:207-b6RNAiCenix:207-b6
PCR_productcenix:207-b6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST01D1.2b Source_evidenceePCR295WS150 Sequence/Annotation Release
Overlaps_Gene T01D1.2 Source_evidenceePCR508WS150 Sequence/Annotation Release
Chunk_score Abs_score299
Max_abs_score299T01D1.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII166873168100
Overlaps_transcript T01D1.2a.3 Source_evidenceePCR508WS150 Sequence/Annotation Release
T01D1.2b Source_evidenceePCR295WS150 Sequence/Annotation Release
T01D1.2a.1 Source_evidenceePCR508WS150 Sequence/Annotation Release
T01D1.2a.2 Source_evidenceePCR508WS150 Sequence/Annotation Release
WB_DNA_textTH:207-b61228cttcaaaacttgaatccggcgctgttgcagcaggtaaaatattataaaacatcaatattttgttcctaaaccaaatcaaaagtttcagctcggcggtggacaaaactatcaagcagtagcctcacttttgtctcttatcaacggacaacagggacaacaacagcagcaccaacagcaacaaaatgttttaggaattttgggaacaggtaaacttagttgataatcattaaaaaattgtacacgtagttcaataaaatataataaaactgaaaaaaacccacggtcgcaatatccgattcagtgctctctgcgctcggcaagctaaccgaaggcggtgacgacgcgtcggcaaagtcctcatcggaaaagccacgccaccaagcgttgatgacgtcaccggcaccgactgccacgtcatcaacctcatcgtcggcttcacatcatcaccagcagcatcagcagcagttatcacagcaacaacaacaacaacaacatccgcagcaacaaggtttaggtgggaaattaggcttctgaaggttgccttgtggatgatatatgaagtgtgtgttctcgtatccctctcgtcggaatgtggacactactgtgtgcttaatctctattttggttgctcacccccctcattttctcatttgccacgtggattgattgattggacggaattttcgcttactgtgttctcgatagcctactgtgtgaatcatccttcttactaacacaatatttccgaaaaaaagatttgtgcgttaagtatgacgcattcggtgtttgcagacacaccgatgtaatgcatcacaattgacgcgcaaatttgtcgaaacagaacgatttacctttttagctaaattcacgaataggttgtttttgtttcggcagtagcgttttatatccgctaatataacatagcatgttgaattaattgaatgcaaagagtgcatagtgtgttttcttttattggggtttgatttttccgtcctgtgcagcttcaagttatccgataaaagtttttgcaggtaacccattgcttggaaatccagctatggctgctcaaaatcaattcgacgctatcacaatggcacagattgctcatcaacagcaaatgctggcactccaagggttcgccgtgcaacagggcgctccaagccaacagcaacaaggtagaatttagcacttttttctctcaattgcagtgtgcgtgtttccttacagc