Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:208-a6   

Cenix:208-a6RNAiCenix:208-a6
PCR_productcenix:208-a6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F10B5.6 Source_evidenceePCR1451WS150 Sequence/Annotation Release
Chunk_score Abs_score1325
Max_abs_score1325F10B5.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII81603488162027
Overlaps_transcript F10B5.6.2 Source_evidenceePCR1451WS150 Sequence/Annotation Release
F10B5.6.1 Source_evidenceePCR1451WS150 Sequence/Annotation Release
WB_DNA_textTH:208-a61680tggctatgtggccaatgttattgagcattgggtgccaaaagtcgtcgattttcctgaaaaaatgttatttttctctcaaataatcatcgaattagatacttactttttcaagacttcttcaattggaatgatttcatcggtctctgtaaccatatacaaaacagttctgaataaaatatcggcttccgcgtaactttttgcagtataggctacacaagcttcttcgtgacgaatcagagggtcattcggtgcccgagcaactgcttctcccatgaacttcttgctcagcttctgactatgcgtactgtactgaagagaagtgtacaagaacggttcagaacttttatccacaagtttcgacgctctgtaatagcaactcatggactgttcgtgttcaacttcatagtgaagaatatgaccaaaagccacccatccttcagcaaacgtcgaatccatcatcgtgcatttacctaaagaagctctatttaaacctcaatgaaatgggaaacatactgatgaaatttcgagctcttgagtttgctccaatactataataatacatagcaacacaataccatggaagtggaatatgaggatcatcactaactagttgatgacctaattcaagcagagatcgagaatcctttaacattgttaggcagtgaatacgaagaataatgcactcaggatgtggtccaaatagatcaaatagctcgtcagtgattttttttgtttctcgaaatcgacccatctcgtaggcacgttgagcacgttccataagaattcgtggatcatgatttccttcgtgtaacttcagctgttcatttctgacttttctgtacttctcccacatcgcaggctcaaccagattgtattttgccattaatcgttcgacatggagagttgtattatcctgaaataataaaacacggtcaaatcatgtataaaagatgacttacaagactcagcgcgtaattaatacaaatcattgcagcatcacgattcatcaatttcaaaaaactttctgctatggttatcataagagctggaaccattctgagctttttagagctattatccaattcggccatatttgcaaatgagtacttcattctttcttcctcgacatatctccccgtcacttgtgaaagtgttcgaacaggaagaggtccaatttggccattacttggaagaagatgaccgaccgataattcagctacatcttcgtataatttccgttggaaaagtgcggtagcggcataataagcaaaaacaatgtgaatctgatgatagttcccacgagcaataatatggctaatacgccgccattgacggagaacgacgagaatttttacgtattcagcgatggtgacaatatcttgctgttcatcatcaattatattagagtataatgtatccgcgtaagctacagcttcatcggttctgccgatttcaagcatttccctaaaaatataacatattaatatatatgctggtctcaaactgacatcactttctccatgctcgcctcgtcataatactccgatccatcaattctacttgcaagtgttttaatcggcttgaaacgaatagactcgtgtttcggcaaatctctgaaaaattgtagtttgaaaaagaaatgttatttattaaactcacaaagatgatgctggcttgctt