Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:208-d2   

Cenix:208-d2RNAiCenix:208-d2
PCR_productcenix:208-d2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC30B5.5 Source_evidenceePCR872WS150 Sequence/Annotation Release
Overlaps_Gene C30B5.5 Source_evidenceePCR872WS150 Sequence/Annotation Release
Chunk_score Abs_score767
Max_abs_score767C30B5.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII62016486203326
Overlaps_transcriptC30B5.5 Source_evidenceePCR872WS150 Sequence/Annotation Release
WB_DNA_textTH:208-d21679acgccttctgcttcttttgatggagtttttgggaatgtttcttgaggaagtagcacgaaagtatccaggcgatgactacacaaaagacgaggcataaggctatgaaaactttctgacgaagttctaaatattgaggaggctgctcacgagactttttctgaaaaaaacaatatttttagaagatattttagcaactcacaaatgtataatacttcatgtttccaaactgatactccgtgaaaagtttctcgattggatctaagagtgccggattatagttttgtttcagtattgcatatccattttctaaaaattgatctacgattttttaaccgatttagatttttgtgcaaaaggtacgttacctggtcttgacacgaaacttttgttaaatgccaaaaggcgtgcgcctttgaagagtagtactgtaatttcgaaatctcgtttctgttaaatttttaacgatttttcattgttttttttgataaataactcttttgaacgaaaaactatggacgattgatgaaatttccgtaggaatggaagtttgaaattacagtactctttagagacgcacgcccgaatgaactctacaaaaaaaatcgtgtcgagaccgggtatcgtattttgggtgcaatttttgcgtctgataaacataactgggatcgtggcaagacccattcagaaaagtaacgtgtgcctttgataaggcgcttcaaactttctcggaattacaatattcaggcaaaccgtacctgtcaatctcattttttcattgtccgttgccacttttgtctcatcgcaataattgaagcaagtgacgggagtgtacttgaaactttctgtaccattagttccaaccttgtctatgaagcaccatggaccatggataccggaaggaatgccagtttcaattgcagatggcgtggaaacagagtacattgggttaacaactgataatttaatatttctgcattttgaatgatggaagctctccgaagcttgttttttcattttctgagaatcactcgcagtggggagccatgattctgtgacctcaatccatggaacacatggttctccattgactgatttgtcgttatttccgagatatttataatcagacattgcttttttgataatacattcagcacctgaaagttcaattttgagatatgacaaatagaaaatgtacttacgaattcggtctttcatgtcgaaatacttcccgtcatataacattccagacgttattctgattaaaatcaagatattgacaagaattttcattttttgagcgttaaataaagataaataaatttttatagaaaaagcattacaacgcggtttcccctaaaatttccgtcattttggaaatacacgttccaaatgttacagatgtgttttttaatcattactcactttgtcgtctatttgtaagattttcgtttaataaatgtaaaatttcgtaacgaaacatgaataagaaattcacaagtttattgaatcacaaccgtatgaagaatttagcaaacataagagttaacaatacaggcacatagtttcaaattaatacatattctttcatttaaaaaaattatgggaactctgtaactgtacacacaacagttccattatcatcgattatgcttgttttacacggtcttccattcgatgtc