Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:21-b12   

Cenix:21-b12RNAiCenix:21-b12
PCR_productcenix:21-b12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS B0261.2a Source_evidenceePCR501WS150 Sequence/Annotation Release
B0261.2b Source_evidenceePCR501WS150 Sequence/Annotation Release
Overlaps_Gene B0261.2 Source_evidenceePCR501WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRI52611205261631
Overlaps_transcript B0261.2a Source_evidenceePCR501WS150 Sequence/Annotation Release
B0261.2b Source_evidenceePCR501WS150 Sequence/Annotation Release
WB_DNA_textTH:21-b12512gatccgtggatcaaatggtttagactatcaattcttgctaaaaggacatgaagatccgagacaagatgaacgtgtgatgcaactttttggactagtcaacacacttcttgccaacaattctgagacttgtcgccgcaatttgactattcaaagatactcgattgtagctttgagcaaagattctggattgattggttgggttccaaattgtgatacacttcatacacttgtcaaggaatatcgagaaaagaaagcaaagattccattgtcgattgagcacaaaacacttcagaaattatcacttgaaactgaacatttgactttaatgcagaagcttcaattatttgaaagtgctctaagtgtaacacaaggagaagatctccgacatgtattatggttgaagagtccgagttctgaagtttggtttgatcgacgaaccaattatacaagatcagttgcatgtatgtcaatggttggatatattcttggtctcggtgacaggtaattcggtt