Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:211-b2   

Cenix:211-b2RNAiCenix:211-b2
PCR_productcenix:211-b2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF22B5.1 Source_evidenceePCR420WS150 Sequence/Annotation Release
Overlaps_Gene F22B5.1 Source_evidenceePCR420WS150 Sequence/Annotation Release
Chunk_score Abs_score381
Max_abs_score381F22B5.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII84441208444859
F22B5.2 Source_evidenceePCR44WS150 Sequence/Annotation Release
Overlaps_transcript (2)
WB_DNA_textTH:211-b2740ttccaatcgagttgggtttctgtccaatgtaaaatatcatagtttgaataaaaatctgatggctaaaaattttcaaacgcaatagaacattttataactcaaaaattccagatgggcttcttgaagattctccgtaagcaacgtgctcgggaacgcgagatgagaatattaattcttggattagacaacgctggaaagactactttaatgaaaaaattcctcgacgagccgactgatacaattgaaccaacattaggatttgatatcaaaaccgtgcatttcaaagattttcaactaaacttatgggatgttggcggacagaaaagtctaagatcttattggaagaattatttcgaatccacagatgctttaatttgggtggtagattcgtcagatagaggtagaaacaaatatttaggatacattcaaatttataaaaacttttttcagagcgtcttctacaatgctccgaagaactcaaaaaattgctcggagaagaacgattagccggtgcttctcttctagttcttgccaacaaaagtgatctgccaggggccattgatgtgaattcaatagcacaggtaattcagatgtcttcagtatatacttccgaaaagaaatgctttcttgtaagccttaacatgtagatatttatattagattcattattcacatgttactctcgtaacatacattttgaaaatgaagaaaatctttaaagaggcacggaaacataggaa