Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:212-f9   

Cenix:212-f9RNAiCenix:212-f9
PCR_productcenix:212-f9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T23D5.8 Source_evidenceePCR138WS150 Sequence/Annotation Release
T23D5.11 Source_evidenceePCR138WS150 Sequence/Annotation Release
Overlaps_Gene T23D5.8 Source_evidenceePCR138WS150 Sequence/Annotation Release
Chunk_score Abs_score96
Specificity_index0.41
Rel_score0.696
Map_statusBest_ePCRV1575081215750960
T23D5.11 Source_evidenceePCR138WS150 Sequence/Annotation Release
Chunk_score Abs_score138
Max_abs_score138T23D5.11
Specificity_index0.59
Rel_score1
Map_statusBest_ePCRV1575764115757789
Overlaps_transcript T23D5.8 Source_evidenceePCR138WS150 Sequence/Annotation Release
T23D5.11 Source_evidenceePCR138WS150 Sequence/Annotation Release
WB_DNA_textTH:212-f9149atgcaactcaccgtgtgaaaaagatactcgaatgtggcgaaaatgaatccaagcacttggaagttcacgagcaagtacttatatgatccgaattgtcgactgatgtgacacaatgtcaggaataccagaatgaagccgaagaatgcatt