Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:213-b6   

Cenix:213-b6RNAiCenix:213-b6
PCR_productcenix:213-b6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW05B10.1 Source_evidenceePCR124WS150 Sequence/Annotation Release
Overlaps_Gene W05B10.1 Source_evidenceePCR146WS150 Sequence/Annotation Release
Chunk_score Abs_score125
Max_abs_score125W05B10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1266243812662583
Overlaps_transcriptW05B10.1 Source_evidenceePCR146WS150 Sequence/Annotation Release
WB_DNA_textTH:213-b6146cgggcagtaataaaacagggatctagctgcgctctccacggatgcgtctggcgagttgcatatcctttggcatgatagtgactcttttggcgtggatggcgcacaggttggtgtcttcgaagagtccaacgaggtaagcttcggaa