Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:22-e3   

Cenix:22-e3RNAiCenix:22-e3
PCR_productcenix:22-e3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC06G3.10 Source_evidenceePCR588WS150 Sequence/Annotation Release
Overlaps_Gene C06G3.10 Source_evidenceePCR588WS150 Sequence/Annotation Release
Chunk_score Abs_score546
Max_abs_score546C06G3.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV70382377038870
Overlaps_transcriptC06G3.10 Source_evidenceePCR588WS150 Sequence/Annotation Release
WB_DNA_textTH:22-e3634atcgcactgttttccgaatcgatgtgtttctaatttaaaataaactaataaattgaatttatccctgatcgacttaagcattgcacggcaggtatgagaagatggccaattatcgataaattcttgagtgagcaagaaacattcatggaaaagtcgtgtgtcacttgggactgcgacggctcccatacactgaaaatacaaataattatgaatataaaaagttatgaacggaaaccttatcaataaatgtcagaatgaacgtgagaagggtttcgtccagaaaacggcggatgtttccacgaaaatgttcagtccccattttttcagcccaagtttcacgcatttttttgacgctttcgaagacttgtttcaagagtttcaactgattactttcgtcgtgtttctcatttacaaattcggcatacaaaagatcagaaaccaagagggcagttagtgaatgcgtactctccgttaacgataaaattgaataaatgagaggaagattttgacaatcaccggcggcacttcgaactccttctgcacagagaaccgcttccagctgagatagaattatcttttcagcggcattttcctcttccgaatggggaaacgtggaacccttcagctctgatgc