Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:221-d1   

Cenix:221-d1RNAiCenix:221-d1
PCR_productcenix:221-d1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF44F4.11 Source_evidenceePCR124WS150 Sequence/Annotation Release
Overlaps_Gene F44F4.11 Source_evidenceePCR124WS150 Sequence/Annotation Release
Chunk_score Abs_score103
Max_abs_score103F44F4.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1091894110919064
Overlaps_transcriptF44F4.11 Source_evidenceePCR124WS150 Sequence/Annotation Release
WB_DNA_textTH:221-d1124gtcactacaccgttggcaaggagctcatcgacactactcttgacagaatccgtcgtctcgccgacaactgtagtggtcttcaaggattctttgtcttccactccttcggtggaggtactggatc