Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:223-e1   

Cenix:223-e1RNAiCenix:223-e1
PCR_productcenix:223-e1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST21B4.2 Source_evidenceePCR96WS150 Sequence/Annotation Release
Overlaps_Gene T21B4.2 Source_evidenceePCR96WS150 Sequence/Annotation Release
Map_statusUnique_ePCRII1249479512494893
Overlaps_transcriptT21B4.2 Source_evidenceePCR96WS150 Sequence/Annotation Release
WB_DNA_textTH:223-e199cgttttgaagggaagactgcacgtgttgcaggtagttgtacatcatgggcgttgcgacaatggcgaccaaggtggcgatggtagccacagagatgcctg