Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:226-d4   

Cenix:226-d4RNAiCenix:226-d4
PCR_productcenix:226-d4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C09D4.5 Source_evidenceePCR251WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRI54850495485315
Overlaps_transcript C09D4.5.1 Source_evidenceePCR251WS150 Sequence/Annotation Release
C09D4.5.3 Source_evidenceePCR251WS150 Sequence/Annotation Release
C09D4.5.2 Source_evidenceePCR251WS150 Sequence/Annotation Release
WB_DNA_textTH:226-d4267acttacgcaagttgcttggctctcttgttctcagtcttcttcttgaagatgtactcgatgagattcttcttgttcttgaagttgtttccctttgcgcgaaggtagagctcgtggtaaaggtgcttgtccaacttcttggcatctctgtatcttctcagaaggtttctgaggacacgcatgcgtcggatccagagggtcttttctggcatacgagcattggcagtaccacgacgctttccgtaaccggtgtgacgtccctaaattcca