Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:228-c8   

Cenix:228-c8RNAiCenix:228-c8
PCR_productcenix:228-c8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST09B4.9 Source_evidenceePCR270WS150 Sequence/Annotation Release
Overlaps_Gene T09B4.9 Source_evidenceePCR270WS150 Sequence/Annotation Release
Chunk_score Abs_score229
Max_abs_score229T09B4.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI61782986178572
Overlaps_transcriptT09B4.9 Source_evidenceePCR270WS150 Sequence/Annotation Release
WB_DNA_textTH:228-c8275tgccggattgtattcttcaacatctcgacagagaacccagatatgattaatacgtttcgggttatctggatctccttcaacaacttttccatcggcattttttgtcacattgatcatgtacacttggaatgaaataatcaaaactgggccttgttccatcatttttccagttgccatttctactttattgatatcaataatccgagaatcttttgtgctaaaatgcattttctgatactctttgacgactgttgatagctgtgtgtaggcctgga