Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:228-d9   

Cenix:228-d9RNAiCenix:228-d9
PCR_productcenix:228-d9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T19E7.2a Source_evidenceePCR275WS150 Sequence/Annotation Release
T19E7.2b Source_evidenceePCR275WS150 Sequence/Annotation Release
Overlaps_Gene T19E7.2 Source_evidenceePCR275WS150 Sequence/Annotation Release
Chunk_score Abs_score254
Max_abs_score254T19E7.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV56518865652160
Overlaps_transcript (8)
WB_DNA_textTH:228-d9275cgaatcttgcgaatcaactgtctttgatactcgctgagactctcgttcttcaacacttgttgcaactcgcttaatgacatctccgaaatctggaacgccgacactggaagctcgttgtcactggcgagctgctcatccttggattgacgtccacgcttccgttgtccgctggccagtggaacaactctcgcgatcttaatcgaagattgtgatgaacgtggagacgatgatcgttggtagcgtgatccactggatggagccaactttccgtagaa